Review

fbe sbe luc (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc fbe sbe luc
Fbe Sbe Luc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fbe+sbe+luc/FBE%2FSBE-Luc+(Plasmid+%2316525)/pmc06220129-100-6-10
Average 88 stars, based on 2 article reviews

fbe sbe luc - by Bioz Stars, 2026-09

88/100 stars

Images

other:

Article Title: Novel tumor growth inhibition mechanism by cell cycle regulator cdk2ap1 involves anti-angiogenesis modulation
Article Snippet: The signaling pathway-responsive reporter (luc) constructs used were obtained from Addgene (Cambridge, MA): pG13-luc (p53 sites, #16442), FBE/SBE-Luc (Smad4 sites, TGFβ1 pathway, #16525), k3(long)-luc (TNFα promoter, #11110), 10-4 cycE-luc (E2F1 sites, #8458), 16xTCF/LEF-luc (TCF/LEF sites, #17165), and NFkB-luc and AP1-luc were obtained from Clontech (Mountain View, CA).

Control:

Article Title: Elevated transforming growth factor β signaling activation in β‐actin‐knockout mouse embryonic fibroblasts enhances myofibroblast features
Article Snippet: .. Plasmids pRL‐SV40P (control vector), SBE4‐Luc, and FBE/SBE‐Luc were purchased from Addgene (Cambridge, MA). ..

Image Search Results

Signaling by IL-27. (a) Example of a PathGen analysis. Output analyses using gene expression and luciferase reporter assay data following IL-27 treatment of osteoblasts. IL-27 is formed by EBI3 and IL27p28 subunits, and it binds to receptor IL27RA (WSX1) with gp130. Image cropped in the center and left edge for summarizing the main signaling connections converging in Smad3, Runx2, Stat1, and Stat3, and other connections seen to BMP2, SPP1, DKK1, and WNT10b . Green, upregulated genes; purple, downregulated genes. (b) Reporter luciferase assay with BRE-Luc (BRE motif binds SMAD1/5/8 and responds to BMP family members). Right plot, reporter luciferase assay with SBE4-Luc (SBE motif binds SMAD2/3/4 and responds to TGFB family members) ( ∗ P < 0.05). OC, differentiating osteoclasts; OB, differentiating osteoblasts.

Journal: Arthritis

Article Title: Combination of Interleukin-27 and MicroRNA for Enhancing Expression of Anti-Inflammatory and Proosteogenic Genes

doi: 10.1155/2017/6365857

Figure Lengend Snippet: Signaling by IL-27. (a) Example of a PathGen analysis. Output analyses using gene expression and luciferase reporter assay data following IL-27 treatment of osteoblasts. IL-27 is formed by EBI3 and IL27p28 subunits, and it binds to receptor IL27RA (WSX1) with gp130. Image cropped in the center and left edge for summarizing the main signaling connections converging in Smad3, Runx2, Stat1, and Stat3, and other connections seen to BMP2, SPP1, DKK1, and WNT10b . Green, upregulated genes; purple, downregulated genes. (b) Reporter luciferase assay with BRE-Luc (BRE motif binds SMAD1/5/8 and responds to BMP family members). Right plot, reporter luciferase assay with SBE4-Luc (SBE motif binds SMAD2/3/4 and responds to TGFB family members) ( ∗ P < 0.05). OC, differentiating osteoclasts; OB, differentiating osteoblasts.

Article Snippet: For luciferase assays, constructs responsive to the active (phosphorylated) form of STAT1 or STAT3 were used (STAT1.GAS/ISRE- and STAT3/3-Luc; Panomics, Fremont, CA) or OPN-, RUNX2-, IL-17a-, TRAF2-, and TLR10-Luc (Switchgear Genomics, Carlsbad, CA) and Tcf/Lef-, BRE-, and SBE/FBE-Luc (SBE4-) or TNF-Luc (12456, 45126, 16525, and 11110, Addgene, Cambridge, MA) and 2% CMV-Bgal (Clontech, Mountain View, CA) as a transfection control to transfect cells using Lipofectamine 3000 or DMRIE-C reagents (Invitrogen, Carlsbad, CA) according to manufacturer's protocols [ ]. miRNA mimics were purchased from Sigma-Aldrich at 5 nmol and utilized in a transfection at a 5 pmol final concentration. miRNA sequences are 100% conserved in human and mouse miRNA according to the miRbase database [ ] and are as follows, miR-17, MIMAT0000070, CAAAGUGCUUACAGUGCAGGUAG , miR-210, MIMAT0000267, CUGUGCGUGUGACAGCGGCUGA , miR-29b-3p, MIMAT0000100, UAGCACCAUUUGAAAUCAGUGUU, miR-20b, MIMAT0001413, CAAAGUGCUCAUAGUGCAGGUAG , miR-10a, MIMAT0000253, UACCCUGUAGAUCCGAAUUUGUG , miR-let7f-5p, MIMAT0000067, UGAGGUAGUAGAUUGUAUAGUU, and miR-21-5p, MIMAT0000076, UAGCUUAUCAGACUGAUGUUGA .

Techniques: Gene Expression, Luciferase, Reporter Assay